How to calculate primer Tm and annealing temperature
The melting temperature (Tm) of a primer is the temperature at which half of the primer–template duplexes have separated. It sets the annealing temperature of your PCR, so a good estimate saves a lot of optimisation.
Three ways to estimate Tm
- Wallace rule: Tm = 2 °C × (A + T) + 4 °C × (G + C). Quick, but only reasonable for oligos under about 14 nt.
- Basic GC formula: Tm = 64.9 + 41 × (G + C − 16.4) ÷ N. Better for longer primers, but ignores sequence order and salt.
- Nearest-neighbor: adds up the stability of each neighbouring base pair (SantaLucia, 1998) and corrects for salt and primer concentration. This is the most accurate and what most modern tools use.
Example
For the 24-mer AGCGGATAACAATTTCACACAGGA (10 G/C, 41.7% GC):
- Wallace rule: 68 °C (overestimates, since the primer is long)
- Basic GC formula: 54.0 °C
- Nearest-neighbor at 50 mM Na⁺ and 250 nM primer: 56.7 °C
The spread shows why the method matters. Differences of several degrees are normal between tools and buffers.
Choosing the annealing temperature
- A common starting point is 3–5 °C below the lower Tm of the pair.
- High-fidelity polymerases often use their own Tm formula and buffer, and their vendors may recommend annealing above the calculated Tm. Use the vendor's calculator for those enzymes.
- When unsure, run a gradient PCR across about 8 °C and pick the highest temperature that still gives a strong, single band.
Primer design checklist
- 18–25 nucleotides, 40–60% GC
- Forward and reverse Tm within 5 °C of each other
- 1–2 G or C in the last five bases at the 3′ end, but not more than 3
- No runs of 4 or more identical bases, and no strong hairpins or self-complementarity
Frequently asked questions
Why do different Tm calculators give different results?
They use different formulas and assume different salt, Mg²⁺ and primer concentrations. Compare tools using the same conditions, and use the polymerase vendor's calculator for their buffer.
Does Mg²⁺ change the Tm?
Yes. Mg²⁺ stabilises DNA duplexes and raises Tm. BenchMath's calculator corrects for Na⁺ only, so in Mg²⁺-containing PCR buffers the real Tm is usually a few degrees higher.
What annealing temperature should I start with?
About 3–5 °C below the lower primer Tm, then optimise with a gradient PCR if needed.